Bảo vệ cây trồng
baovecaytrong.com
  KỸ THUẬT TRỒNG TRỌT» email Thứ Tư, 20/9/2017
Cây Trồng  

Các phương pháp phát hiện virus gây bệnh cho lan

Hai loại virus chính gây hại nghiêm trọng cho lan là virus CymMV (Cymbidium mosaic virus) và ORSV (Odontoglossum ringspot virus). Việc phát hiện sớm để ngăn ngừa và kiểm soát virus gây nhiễm là vấn đề then chốt đặt ra cho các nhà nông cũng như là các nhà nghiên cứu nuôi trồng lan.


Đối với các nhà vườn lan, thì việc khó khăn và nguy hại nhất là sự gây hại nghiêm trọng của các tác nhân gây bệnh cho cây lan, gồm có côn trùng, nấm, vi khuẩn, virus. Trong đó, mức độ tác hại do virus gây ra là nghiêm trọng nhất vì không phát hiện sớm ở giai đoạn đầu và mức độ lây lan cao. Trong đó hai loại virus chính gây hại nghiêm trọng cho lan là virusCymMV (Cymbidium mosaic virus) và ORSV (Odontoglossum ringspot virus). Do vậy, việc phát hiện sớm để ngăn ngừa và kiểm soát virus gây nhiễm là vấn đề then chốt đặt ra cho các nhà nông cũng như là các nhà nghiên cứu nuôi trồng lan. Mà đặc biệt là làm sao có thể dễ dàng phát hiện và chẩn đoán sớm 2 loại virus này bằng các kỹ thuật thật đơn giản, ít tốn kém là điều bận tâm rất lớn của các nhà nông. Cũng đã có rất nhiều nghiên cứu tìm phương pháp tối ưu nhất để phát hiện 2 loại virus này, bao gồm các phương pháp miễn dịch như ELISA, RIPA (rapid immunofilter paper assay); phương pháp PCRcác test nhanh; phương pháp sắc ký;… Hiện nay, cũng có nhiều sản phẩm đang lưu hành trên thị trường dùng để phát hiện 2 loại virus này như: kit DAS-ELISA của hãng DSMZ (D-0187, D-0493, D-0100), các test thử nhanh của Agdia, các kit Monoplex, Multiplex RT-PCR,…

 

    I. Phát hiện virus gây hại lan bằng cách test thử nhanh

    Các loại test thử nhanh này dùng để sàng lọc và phát hiện sớm các mẫu nghi ngờ bị nhiễm bệnh, nhằm ngăn ngừa và kiểm soát bệnh hiệu quả. Cách sử dụng các loại test thử này rất đơn giản, nhanh chóng và không cần đầu tư trang thiết bị hiện đại hay kiến thức chuyên sâu như phương pháp chẩn đoán khác ELISA, PCR. Chúng rất tiện lợi khi mang theo và thực hiện ở bất cứ nơi nào trong nhà kính hay vườn nuôi mà không cần gửi mẫu đến phòng thí nghiệm, vì vậy chúng phù hợp và tiện lợi cho nông dân nuôi trồng lan. Giá thành so với phương pháp ELISA hay PCR cũng ít hơn rất nhiều.

Về nguyên tắc của các test này là: dựa vào phản ứng tạo màu khi có sự hiện diện của 1 kháng nguyên (protein màng bao của virus), kết hợp chuyên biệt với kháng thể tạo phức hợp có màu nhìn thấy được bằng mắt thường.

Hiện nay, trên thị trường thế giới có rất nhiều dạng test kit này của các công ty nổi tiếng, có uy tín. Ở đây tôi xin giới thiệu 1 số sản phẩm để tham khảo:

 

    1. Kit Agdia Orchid ImmunoStrip®

    Kit thử nhanh Agdia Orchid ImmunoStrip® của hãng Agdia (www.agdia.com) là một trong những kít được sử dụng phổ biến nhất để phát hiện đồng thời 2 loại virus gây bệnh cho thực vật, virus chính gây tác hại nghiêm trọng cho công tác nuôi trồng lan là Cymbidium mosaic virus (CymMV) và Odontoglossum ringspot virus (ORSV). Kit này rất tiện lợi cho việc phát hiện đồng thời cả hai loại virus trên chỉ trong vòng ít phút. Kết quả được thể hiện rất rõ ràng và cách sử dụng đơn giản, tiện lợi khi dùng bất cứ ở đâu trong vườn hay nhà kính. Chỉ cần cho mẫu nghi ngờ vào túi chuyên dụng đã chứa sẵn dung dịch đệm SEB1 của kít và đặt các que thử (strip) vào trong túi. Kết quả dương tính thể hiện mẫu nhiễm virus khi có sự xuất hiện vạch màu trong vòng 20-30 phút khi so sánh với mẫu đối chứng: kết quả xuất hiện 3 vạch màu là nhiễm cả 2 loại virus; test xuất hiện 2 vạch nghĩa là chỉ nhiễm 1 loại virus (CymMV hoặc ORSV) và âm tính khi chỉ xuất hiện 1 vạch màu (chi tiết ở hình 1):

 

Hình minh họa kết quả phát hiện virus CymMV và ORSV bằng kit Agdia (www.agdia.com)

 

    2. Pocket Diagnostics Orchid virus screen - Cymbidium mosaic virus and Odontoglossum ringspot virus

Sản phẩm gồm có 1 pack silica chứa 1 test phát hiện CymMV, 1 test phát hiện ORSV, 1 ống chứa dung dịch tách chiết (extraction bottle), 1 pipett nhựa, vài vòng bi thép sạch.

 

Các sản phẩm của kit Pocket Diagnostics Orchid virus screen (http://jwund.homestead.com/pdviruskit.html)

 

    Cách thực hiện kit này rất dễ dàng tiện dụng, không cần kinh nghiệm và dễ bảo quản (lưu trữ ở nhiệt độ phòng, khô thoáng):

·         Sử dụng mẫu lá mới nhất nghi ngờ nhiễm bệnh.

·         Cắt các mẫu mô lá này thành những mảnh nhỏ có kích thước khoảng 5-7mm theo chiều rộng, và chiều dài khoảng 1-2cm, sau đó lát mỏng các mẫu lá này theo chiều dọc. Đối với mẫu hoa, chỉ cần cắt nhỏ.

·         Thực hiện 3 vạch cắt chéo ngang mẫu lá đã lát mỏng, và đặt vào trong extraction bottle.

·         Lắc trong vòng 30 giây. Lấy vài giọt mẫu sau khi lắc nhỏ vào giếng tròn của dụng cụ test phát hiện virus.

·         Trong vòng 3-5 phút kết quả xuất hiện sẽ cho biết mẫu dương tính hay âm tính: kết quả dương tính có 2 vạch màu xuất hiện ở dòng ghi chữ C (đối chứng) và T (virus ORSV hoặc CymMV ), kết quả âm khi chỉ có 1 vạch ở dòng ghi chữ C.

 

Kết quả phát hiện virus với kit Pocket Diagnostics Orchid virus screen (http://jwund.homestead.com/pdviruskit.html)

 

    II. Phát hiện virus gây hại lan bằng RT-PCR

    Phát hiện virus gây hại bằng RT-PCR là một phương pháp có độ tin cậy cao hơn các phương pháp khác. Bằng cách phát hiện sự hiện diện của 1 gene nào đó của virus, cụ thể đối với virus CymMV và ORSV là gene CP (coat protein gene), gene tổng hợp protein màng bao của virus. Tuy nhiên, sử dụng phương pháp này rất tốn kém, đòi hỏi phải có phòng thí nghiệm tân tiến, có trang thiết bị hiện đại, đầy đủ, như máy PCR, bộ điện di, máy chụp gel, các thiết bị chuyên dùng khác và hóa chất rất đắt tiền. Và đòi hỏi người thực hiện phải có trình độ chuyên môn cao.

Qui trình thực hiện bao gồm các bước cơ bản như sau:

 

    Tách chiết RNA:

    RNA tổng số được tách chiết từ mô lá của mẫu Lan nghi ngờ và 1 mẫu thực vật làm đối chứng theo hướng dẫn kit tách chiết (ở đây tôi trình bày tóm tắt cách sử dụng của kit Plant Total RNA Extraction Miniprep system; Vio gene, Mỹ):

·         100mg mô lá lan được nghiền ra trong nitơ lỏng. Chuyển vào eppendorf.

·         Bổ sung 450µl RX buffer. Trộn đều.

·         Lọc dung dịch qua cột (Shearing tube column).

·         Rửa cột với 230µl ethanol tuyệt đối. Lọc dung dịch qua cột (Plant total RNA tube column) của kit.

·         Rửa cột 1 lần với dung dịch WF, và 2 lần với dung dịch WS.

·         Hòa RNA tổng số trong 50µl nước cất 2 lần.

·         Đo nồng độ RNA thu được.

·         Lưu trữ -80oC đến khi dùng.

 

    Trình tự primer:

Cặp primer tổng hợp gene CP của virus CymMV; sản phẩm có kích thước 669bp:

CymMV CP-F1: ATGGGAGAGYCCACTCCARCYCCAGC

CymMV CP-R1 TTCAGTAGGGGGTGCAGGCA.

 

Cặp primer tổng hợp gene CP của virus ORSV; sản phẩm có kích thước 474bp:

ORSV CP-F1 ATGTCTTACACTATTACAGACCCG.

ORSV CP-R1 GGAAGAGGTCCAAGTAAGTCC.

 

Cặp primer tổng hợp gene nad5 mRNA của thực vật dùng làm chứng nội; sản phẩm có kích thước 185 bp:

mt-F2 GCTTCTTGGGGCTTCTTGTTCGATA

mt-R1 ATCTCCAGTCACCAACATTGGCAT

 

    a. Thực hiện phản ứng Monoplex RT-PCR:

        Chuẩn bị phản ứng RT:

       Đối với mẫu phân tích: (Chuẩn bị mẫu đối chứng tương tự ngoại trừ không có sản phẩm RNA của virus sau tách chiết):

Trộn từng loại 2µl RNA tổng số (virus và thực vật) (nồng độ khoảng 200ng) đã tách chiết ở trên tương ứng với từng loại 0.5µl primer ngược (nồng độ 5µM):

·         RNA của virus CymMV: sử dụng primer CymMV CP-R1.

·         RNA của virus ORSV: sử dụng primer ORSV CP-R1.

·         RNA của thực vật: sử dụng primer mt-R1.

 

    Tiếp tục trộn hỗn hợp trên với 5µl nước cất 2 lần. Đun 10 phút ở 70oC, làm lạnh ngay trên đá trong 5 phút. Tiếp tục bổ sung vào hỗn hợp RT gồm:

Nước cất 2 lần                                                3.25µl

Buffer (5x, Promega)                                        2.5µl

dNTPs (10mM)                                                1.25µl

RNasin (40 U/µl, Promega)                                 0.25µl

AMV reverse transcriptase (10 U/l, Promega)        0.25µl

 

    Ủ phản ứng trên ở 42oC trong 60 phút. Tiếp tục bổ sung các hóa chất sau để tiến hành phản ứng PCR: (sử dụng mỗi cặp primer cho từng mẫu RNA tương ứng):

Sản phẩm của phản ứng RT                                                  2µl

DyNAzyme II DNA polymerase buffer (10x, Finnzymes Inc.)       2µl

1 cặp Primer xuôi và ngược (5µM)                                          2µl

dNTPs (2 mM)                                                                    2µl

DyNAzyme II DNA polymerase enzyme (2 U/ µl, Finnzymes Inc.) 0.4µl

Nước cất 2 lần                                                                  11.6µl.

 

    Sau khi đã chuẩn bị, tiếp theo là đặt các phản ứng vào máy PCR và thiết lập chương trình phản ứng như sau:

Bước 1: biến tính ở 96o C trong 5 phút.

Bước 2: 96o C trong 30 giây.

Bước 3: 52o C trong 30 giây.

Bước 4: 72o C trong 30 giây.

Lặp lại 30 chu kỳ từ Bước 2 đến Bước 4.

Bước 5: 72o C trong 7 phút.

 

    Và cuối cùng là phân tích sản phẩm khuếch đại trên gel agarose, nhuộm gel và quan sát trên máy đọc UV để xác định kích thước các vạch DNA xuất hiện trên gel khi so sánh với thang chuẩn DNA ladder 1kb Plus (Invitrogen). Từ đó suy ra kết quả.

 

    b. Thực hiện phản ứng Multiplex RT-PCR:

Chuẩn bị và thực hiện tương tự như Monoplex RT-PCR. Tuy nhiên, có vài điều khác biệt cần lưu ý:

 

    Phản ứng RT:

    Được chuẩn bị và thực hiện tương tự như phản ứng Monoplex RT-PCR, ngoại trừ 3 primer ngược (primer reverse CymMV CP-R1, ORSV CP-R1 và mt-R1) là được cho vào đồng thời trong cùng một phản ứng. Và nồng độ RNA của virus có thể pha loãng bậc 10 thành nhiều nồng độ (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg và 1 fg) để xác định ngưỡng phát hiện của phản ứng Multiplex RT-PCR sau này.

   

  

 

Thủy Tiên dịch và tổng hợp 

 

 

Nguồn tham khảo và tổng hợp:

  1. Shu-Chuan Lee1 and Ya-Chun Chang. Multiplex RT-PCR detection of two orchid viruses with an internal control of plant nad5 mRNA.Plant Pathology Bulletin 15:187-196, 2006.

2.     M. Navalinskienë, J. Raugalas, M. Samuitienë. Viral diseases of flower plants. Identification of viruses affecting orchids (Cymbidium Sw.). BIOLOGIJA. 2005. Nr. 2. P. 29–34.

3.     S. Tanaka, H. Nishii, S. Ito, and M. Kameya-Iwaki, and P. Sommartya. Detection of Cymbidium Mosaic Potexvirus and Odontoglossum Ringspot Tobamovirus from Thai Orchids by Rapid Immunofilter Paper Assay. Plant Disease / Vol. 81 No. 2, p.167-170. 1997.

4.     J. S. Hu, S. Ferreira, M. Wang and M. Q. Xu. Detection ofCymbidium Mosaic Potexvirus, Odontoglossum Ringspot virus, Tomato spotted wilt virus, and potyviruses infecting orchids in HawaiiPlant Disease / Vol. 77 No. 5, p.464-468. 1993.

5.     K. Yamane, K. Oyama, E. Iuchi, H. Ogawa, T. Suzuki and T. Natsuaki. RT-PCR Detection of Odontoglossum ringspot virus, Cymbidium mosaic virus and Tospoviruses and Association of Infections with Leaf-Yellowing Symptoms in Phalaenopsis. Journal of PhytopathologyVolume 156 Issue 5, Pages 268 – 273; 2008.

6.     http://www.agdia.com.

7.     http://www. RapidDiscovery.biz.

8.     http://www. dsmz.de/plant viruses.

9.     http://jwund.homestead.com/pdviruskit.html. 

Theo svcsaigon.com

[Về Trang Trước]


TIN TỨC
KỸ THUẬT

Cây màu xen thanh long

BẢO VỆ THỰC VẬT

Ong ký sinh phòng trừ rệp sáp bột hồng hại sắn

PHÂN BÓN

Phân bón nào phù hợp thổ nhưỡng, cây trồng Tây Nguyên?

GIỐNG CÂY

Phục tráng giống lúa Cáy Nọi

KINH NGHIỆM NHÀ NÔNG
Ươm cao su giống, thu tiền tỷ
BÀN TRÒN

Bệnh ở cây lộc vừng

Bản quyền © 2010-2013 Thuộc về baovecaytrong.com.